InterLink Headline News 2.0

La niña serpiente

Su nombre es Nokulunga Buthelezi, tiene 18 años y trabaja en un circo. Su talento reside en poder hacer contorsionismos como si no tuviera huesos.

Nokulunga Buthelezi es una contorsionista proveniente de Africa. La prensa ya la bautizó “la niña serpiente” por las posiciones que logra con sus extremidades.

Esta niña tiene habilidades especiales desde que era muy pequeña: a los tres años de edad su mamá la encontró durmiendo con las piernas enrolladas en su cuello.

Cuando cumplió seis años, se unió a un circo en los Estados Unidos y se convirtió en la estrella principal de “Afrika! Afrika!”.

“Mi mama vio a alguien hacienda acrobacias. Ellos le hablaron sobre unas audiciones para un circo. Me llevó y se quedaron impresionados”, contó.

Pero Nokulunga no es la única rareza del espectáculo: Makaya Dimbelelo es la “araña humana”, que puede pasar su cuerpo por una raqueta de tenis.

Entre los talentos de “Afrika! Afrika!” se destaca el “hombre de agua”, que traga cinco litros de agua y los devuelve como si fuera una fuente.

En: Curiosidades — January 20, 2008


Para hacer un trackback a este post usa esta URL


Los comentarios de este post en RSS
  1. guau, q genial es esto. Pero. ¿Saben lo q haria una mordedura o picadura de una serpiente? vi una pagina y es horrible me causo nauseas… Felicidades a la niña serpiente

    nicole - August 12, 2009 @6:20 pm
  2. guuuauu qe suabe yo soy gimanasia te estoy ablando desde mi lapto yo sor rica como tu adios qe sigas estirandote mas

    alondra gisel - November 21, 2009 @1:23 pm

    KANZA - January 16, 2010 @8:21 pm
  4. guauuuuuuu k emocionante es totalmente increible, deberias traer mas informacion sobre esto me encanta. gracias …….

    Miki - yu - March 3, 2010 @10:07 am
  5. fantastic¡¡¡¡

    romina - June 6, 2010 @7:41 pm
  6. ggggguuuuuuuaaaaaaauuuuuuu fantastico ,lo maximo bueno nunca habia visto a una persona doblarse con tanta flexibilidad
    puedes llegar muy lejos con el talento k tienes
    sigue asi
    suerte Nokulunga eres una buena contorsionita
    y para todos los demas contorsionitas suerte tambien bye

    jazmin - June 28, 2010 @12:55 am
  7. Como se le verá el agujero del otro lado, será que le gusta que así se la penetren?

    ado - September 12, 2010 @8:16 pm
  8. yo le deseo muxa suerte es la mejor gimnasta y contornista y si alguien dice lo contrario creyendose mas los dms correra sangre nadie sab quien soy pero algo les digo …. soy mujer

    anonima - October 21, 2010 @9:26 pm
  9. Miedooo 😀

    Lupita - November 11, 2010 @5:38 pm
  10. Esa niña es interesante. Y me gusta como hace la serpiente.

    aramata - November 12, 2010 @6:21 am

    WALTER CISNEROS - June 13, 2011 @6:17 pm
  12. felicidades sos una chca muy especial somos pocos los que tenemos esas habilidades,dones muy bien

    WALTER CISNEROS - June 13, 2011 @6:18 pm

Bienvenido a InterLink Headline News 2.0, el primer diario digital de la Argentina, que se publica todos los días desde el 31 de Enero de 1995.

Editores (ir)responsables: Alejandro Piscitelli y Raúl Drelichman

Secretaria de Redacción: Anaclara Dalla Valle
Siempre son bienvenidos los colaboradores voluntarios

Editores Invitados recientes: Carlos Scolari, Julian Gallo, Marcelo de la Torre, Hugo Pardo, Mariano Legname, Ariana Atala y varios más..

ISSN 1514-349X




Ingrese su email para recibir las actualizaciones. Pulse ENTER al terminar de escribir

 RSS  Feed RSS  


Pulsa ENTER al terminar de escribir

Tag Cloud

  • Archivo


    Léanos en Facebook


    El Paréntesis de Gutenberg. La Religión Digital en la era de las pantallas ubicuas
    Alejandro Piscitelli
    ISBN 978 950 46 2419 6 Santillana 2011

    Hackear el periodismo. Manual de Laboratorio
    Pablo Mancini
    La Crujia 2011

    El Proyecto Facebook y la posuniversidad. Sistemas operativos sociales y entornos abiertos de aprendizaje
    Alejandro Piscitelli
    Ariel 2010

    1@1 Derivas en la Educación Digital
    Alejandro Piscitelli
    ISBN 978-950-46-2246-8 Santillana 2010


    Nativos Digitales, Dieta cognitiva, Inteligencia Colectiva y Arquitecturas de la Participación
    Alejandro Piscitelli
    ISBN 978-950-46-2131-7 Santillana - 2009


    Internet: la imprenta del siglo XXI
    Alejandro Piscitelli
    ISBN: 8497840607 Gedisa - 2005

    Internet: la imprenta del siglo XXI


    Ciberculturas 2.0 En la era de las máquinas inteligentes
    Alejandro Piscitelli
    ISBN 950-6970-1 Paidós - 2002

    Ciberculturas 2.0 En la era de las máquinas inteligentes

    WordPress & Dalarnas

    InterLink Headline News 2.0 © 1995 — 2016 | ISSN 1514-349X